SGN Marker TG420

SGN-M615

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTTCTTTGTCCTTGGGAACCTGGAAGTAACATAAAATTAAATGGTAATGCAATTCCCACCATGTGGAGTACCCAATTGTCAACTTTACTT
AGAGATTCGGTATCTAGGTTTTCTTTTTTATATTTTAGAAGTGAATGTCTATGAACAAAGTATATGACCAATATTTTTCATGACATGTAA
ACCTCATGTCGGAAGATGCATTGCTATCGGAAAAATTAACTATAAAGAAGTTCAGTGCTGTGCTTTGGGAAAATGATTTAAGAGAACAGG
TGTAAACACCAATTCGGTGTCTTCCTATTTGCCCCACTATCTACATTGTTACCAGAACAAAGAACTAACATATCAGTTGCTAGATAGTGT
CATAATCCAGAAAGTAAATTTAAAAAGGCTCCAAAGGCCAGTGTGTTCTAGACTTTGGCAATTTATAATGATAATGAAGTAACGATCCCC
AAGGATGAACTTATGCTAGATAATAGGCACTACCAAC
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53308)
Chromosome
10
Position
80.38 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42458)
Chromosome
10
Position
127.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40037)
Chromosome
10
Position
52.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9630)
Chromosome
10
Position
102.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9629)
Chromosome
10
Position
52.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9633)
Chromosome
10
Position
44.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG420 was used as an overgo probe on plate 5 [well H12]

Plausible BAC Matches:   P181A21,   P215A01,   P057G01,   P071E19

 Overgo Sequences

A sequence
TGGTAATGCAATTCCCACCATGTG
B sequence
TGACAATTGGGTACTCCACATGGT
AB sequence
TGGTAATGCAATTCCCACCATGTGGAGTAC
Marker sequence
CTTCTTTGTCCTTGGGAACCTGGAAGTAACATAAAATTAAATGGTAATGC
AATTCCCACCATGTGGAGTACCCAATTGTCAACTTTACTTAGAGATTCGG
TATCTAGGTTTTCTTTTTTATATTTTAGAAGTGAATGTCTATGAACAAAG
TATATGACCAATATTTTTCATGACATGTAAACCTCATGTCGGAAGATGCA
TTGCTATCGGAAAAATTAACTATAAAGAAGTTCAGTGCTGTGCTTTGGGA
AAATGATTTAAGAGAACAGGTGTAAACACCAATTCGGTGTCTTCCTATTT
GNNNNACTATCTACATTGTTACCAGAACAAAGAACTAACATATCAGTTGC
TAGATAGTGTCATAATCCAGAAAGTAAATTTAAAAAGGCTCCAAAGGCCA
GTGTGTTCTAGACTTTGGCAATTTATAATGATAATGAAGTAACGATCCCC
AAGGATGAACTTATGCTAGATAATAGGCACTACCAAC
Genomic location of TG420  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D615 marker 615
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)