SGN Marker CT253

SGN-M617

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTAAAATTAGAAGTTAATAGAGCTTGAATATGTTTGTCCAAATCGCCAATTGGATGAAGCAACATTTAAGAATGTTT
TAGTGACACCATCTGATGTTGTGACCTTAAATGACAAAGATTGTCCATTAAGAAATGCATTTGATTGCCAATTGGCCCCCCAATTTCTAG
CCATTGTCATCCAATTGGTTCTTGATCCTTTAATTTGTACTGATTGAATTGATCCAGCCCCTCCTACATTACTTATCATTAATAGCTCAA
AATAGTCCCTTCCATTTATTGTAAATCTAACTCCACCTTTTTTCACACAAGGAATCCTTTGGTACATGACGGGAACAATGCCACCTCTGT
AGATACCAATTTTTTCCCAAGCAGGTTGAGCCATGTCAAAATGTGGCCTTGGTGGGTTGCACCATCCACCATTATTGCTAGGAAGTGCAA
AATTTGGTGGACAAAAATTAGTGGCTGTAATTGTCATAGATGTTC
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1597981.3e-38204 (41.2% of RFLP seq)+
SGN-U146739480 (97.0% of RFLP seq)+
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42964)
Chromosome
4
Position
60.60 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43964
Forward primer (5'-3')
TAGAGCTTGAATATGTTTGTCCA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ATGGCTGAACCTGCTTGGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39035)
Chromosome
4
Position
135.80 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39036)
Chromosome
12
Position
85.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 9642)
Chromosome
12
Position
78.76 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9639)
Chromosome
4
Position
119.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT253 was used as an overgo probe on plate 9 [well D7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTTCCCAAGCAGGTTGAGCCATGT
B sequence
CCAAGGCCACATTTTGACATGGCT
AB sequence
TTTCCCAAGCAGGTTGAGCCATGTCAAAAT
Marker sequence
CTTTTTTTTTTTTTTAAAATTAGAAGTTAATAGAGCTTGAATATGTTTGT
CCAAATCGCCAATTGGATGAAGCAACATTTAAGAATGTTTTAGTGACACC
ATCTGATGTTGTGACCTTAAATGACAAAGATTGTCCATTAAGAAATGCAT
TTGATTGCCAATTGGCCCCCCAATTTCTAGCCATTGTCATCCAATTGGTT
CTTGATCCTTTAATTTGTACTGATTGAATTGATCCAGCCCCTCCTACATT
ACTTATCATTAATAGCTCAAAATAGTCCCTTCCATTTATTGTAAATCTAA
CTCCACCTTTTTTCACACAAGGAATCCTTTGGTACATGACGGGAACAATG
CCACCTCTGTAGATACCAATTTTTTCCCAAGCAGGTTGAGCCATGTCAAA
ATGTGGCCTTGGTGGGTTGCACCATCCACCATTATTGCTAGGAAGTGCAA
AATTTGGTGGACAAAAATTAGTGGCTGTAATTGTCATAGATGTTC
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT253  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D617 marker 617
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)