SGN Marker TG59

SGN-M62

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TCGACCTGCAGATATTTCATAAAAGAATGCCCCCTGAAGCAGTTGATTTGGTGTCGAGGCTTCTCCAATATTCTCCAACTCTACGCTGCA
CTGCTGTAAGTAAAAAGTTTTCTTCTCAATTATCAAGTATTTAGGATATTCTGGTAGTTTCCCATTTTACCCATCATTCAAACATGGTGT
TCCATTTTTGTTATGTTTCAATATGCGAGTTCTCATTGATTGTCCTTTTAGCACTTCTGTTTTCCGGGGATATTGAGAACATTTTGTGTT
TATTGACAGTTGGAAGCATGTGCACACCCTTTCTTTGATTCTTTAAGGGAACCAAATGCTTGCTTGCCAAATGGGCGACCTCTGCCTCCC
CTATTCAACTTTTCACCTCAAGGTGAGCTTCAGTCTAGCTTTCTCCTTTTATTTCACATGATTTGATACGTCAAT
Reverse sequence
AGTTGGGAATTATATCCTGTTCAGTAGACAAATTACCCAACCAGAATATACGTACCTGAATGTTCATGTGATAGATAAGTCCATACTAGT
ACTTCTGTCTTGTGAATATCTGTGTGTTGCCTTGTGAGTAAGGATATTCATTGCTCCAATGCAAAACCATTATGTCATTGTCTTAGGGAG
CTTTCTGTTGTTTGTATGGCATGAAAAGTTAATCCTAAAAGAAAGGTAAAGTAAAGGTGCATCCTAGGTTAGTATAATGTTCTGAAGGCA
AAGATGTTTTTCTTTTGATTTAAACTTATGTTTTTTTTTCTTTGATTCCGTCTCCTTCCCTAATAGCAAAAACTGGGAAGTTGAAACTAC
GTTATAACTGGACAACCTCATAAATGAAAAAGATGGTAAATAATGCCATTTCTGGGGTGGGGTAATTTTCCTTAGATGAGTGTGATACTG
TTGTACCTGTTGCTTGAACTCCTAAGTTTCCTCATTTTCTTCCTTTTTGTTTATGCTAAATGCCGTGTGTACTGTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1444253e-0552 (12.0% of RFLP seq)+
SGN-U1468772e-0682 (18.9% of RFLP seq)+
SGN-U1463088.6e-1592 (21.1% of RFLP seq)+
SGN-U1463073.1e-4286 (19.8% of RFLP seq)+
SGN-U1463072.2e-52103 (23.7% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53572)
Chromosome
1
Position
67.18 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53361)
Chromosome
1
Position
69.59 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43882)
Chromosome
1
Position
78.90 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43621)
Chromosome
1
Position
57.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43344)
Chromosome
1
Position
78.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42492)
Chromosome
1
Position
90.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40822)
Chromosome
1
Position
94.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36567
Forward primer (5'-3')
TCAGCGTTATGTTGCTCCAG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGGAAGTGCTTCACGCTCTA
Digested band sizes (using BstNI)
Solanum pennellii TA56
440
Solanum lycopersicum TA209
289
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40103)
Chromosome
1
Position
62.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7914)
Chromosome
1
Position
93.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 7916)
Chromosome
1
Position
106.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7915)
Chromosome
1
Position
51.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7921)
Chromosome
1
Position
32.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7920)
Chromosome
1
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 35634
Forward primer (5'-3')
TGCACACCCTTTCTTTGATTC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 1800
Solanum pennellii LA716: 900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTTCTATCAAGTCCATCCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1800
Solanum pennellii LA716: 1800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG59 was used as an overgo probe on plate 14 [well D9]

Plausible BAC Matches:   P125E01,   P032M01,   P014A17,   P238F22,   P142O01,   P247L13,   P262I05

 Overgo Sequences

A sequence
TTTGGTGTCGAGGCTTCTCCAATA
B sequence
GCGTAGAGTTGGAGAATATTGGAG
AB sequence
TTTGGTGTCGAGGCTTCTCCAATATTCTCC
Marker sequence
TCGACCTGCAGATATTTCATAAAAGAATGCCCCCTGAAGCAGTTGATTTG
GTGTCGAGGCTTCTCCAATATTCTCCAACTCTACGCTGCACTGCTGTAAG
TAAAAAGTTTTCTTCTCAATTATCAAGTATTTAGGATATTCTGGTAGTTT
CCCATTTTACCCATCATTCAAACATGGTGTTCCATTTTTGTTATGTTTCA
ATATGCGAGTTCTCATTGATTGTCCTTTTAGCACTTCTGTTTTCCGGGGA
TATTGAGAACATTTTGTGTTTATTGACAGTTGGAAGCATGTGCACACCCT
TTCTTTGATTCTTTAAGGGAACCAAATGCTTGCTTGCCAAATGGGCGACC
TCTGCCTCCCCTATTCAACTTTTCACCTCAAGGTGAGCTTCAGTCTAGCT
TTCTCCTTTTATTTCACATGATTTGATACGTCAAT
Genomic location of TG59  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D62 marker 62
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)