SGN Marker TG353

SGN-M625

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTGAAGCATGAATAACATCGAGTAGTCCATCCGTTGCACGAGCAAGATAGCAATGATCAATCCAAACATTGGACGATGTAAACACACTTA
TAGCATCACCATCAGAGCCTGATCTTTCACCAACATGTTCAGGACTACTCCTAACCATACCCTTTTTACCAGGCTTACAATCATGAATAC
TAATCCCATGAATAATAACATTTGTGACATAGTCCAATGTGATACATGGACCATTAGAGATTTCCACTTTTGCTCCTCTGCCATCGATAG
TCTTATAACTATTCACCATAAGTTCATTTTCAAGTGTAAGTACCATGTCCCTTTTGAAAATTATCCAAAGTGGCTCGGACTGAATTGCAC
CATACCTAAGTGTGCCTGGTTTAGGATTTATAGGGTCATCAGAAGAGTCATTCACAATATAAATGTCACCATATTTACCACCTATGGTAC
TACTTCCAAAGCCTATTGCACAATCCGCTAAAGCCTTTCGATTGGATGACCAATCACCTTTCCATCTCCAACACGAATCGAT
Reverse sequence
TATAGGGAGACAAGCTTGCATGCCTGCAGTTGAAGCATGAATAACATCGAGTAGTCCATCCGTTGCACGAGCAAGATAGCAATGATCAAT
CCAAACATTGGACGATGTAAACACACTTATAGCATCACCATCAGAGCCTGATCTTTCACCAACATGTTCAGGACTACTCCTAACCATACC
CTTTTTACCAGGCTTACAATCATGAATACTAATCCCATGAATAATAACATTTGTGACATAGTCCAATGTGATACATGGACCATTAGAGAT
TTCCACTTTTGCTCCTCTGCCATCGATAGTCTTATAACTATTCACCATAAGTTCATTTTCAAGTGTAAGTACCATGTCCCTTTTGAAAAT
TATCCAAAGTGGCTCGGACTGAATTGCACCATACCTAAGTGTGCCTGGTTTAGGATTTATAGGGTCATCAGAAGAGTCATTCACAATATA
AATGTCACCATATTTACCACCTATGGTACTACTTCCAAAGCCTATTGCACAATCCGCTAAAGCCTTTCGATTGGATGACCAATCACCTTT
CCATCTCCAACACGAATCGATGACAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9657)
Chromosome
2
Position
46.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9658)
Chromosome
2
Position
63.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG353 was used as an overgo probe on plate 16 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAACATCGAGTAGTCCATCCGTTG
B sequence
TGCTATCTTGCTCGTGCAACGGAT
AB sequence
TAACATCGAGTAGTCCATCCGTTGCACGAG
Marker sequence
TTGAAGCATGAATAACATCGAGTAGTCCATCCGTTGCACGAGCAAGATAG
CAATGATCAATCCAAACATTGGACGATGTAAACACACTTATAGCATCACC
ATCAGAGCCTGATCTTTCACCAACATGTTCAGGACTACTCCTAACCATAC
CCTTTTTACCAGGCTTACAATCATGAATACTAATCCCATGAATAATAACA
TTTGTGACATAGTCCAATGTGATACATGGACCATTAGAGATTTCCACTTT
TGCTCCTCTGCCATCGATAGTCTTATAACTATTCACCATAAGTTCATTTT
CAAGTGTAAGTACCATGTCCCTTTTGAAAATTATCCAAAGTGGCTCGGAC
TGAATTGCACCATACCTAAGTGTGCCTGGTTTAGGATTTATAGGGTCATC
AGAAGAGTCATTCACAATATAAATGTCACCATATTTACCACCTATGGTAC
TACTTCCAAAGCCTATTGCACAATCCGCTAAAGCCTTTCGATTGGATGAC
CAATCACCTTTCCATCTCCAACACGAATCGAT
Genomic location of TG353  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D625 marker 625
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)