SGN Marker TG496

SGN-M641

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
TGGAAGTGAGAGATTTCATTGGCGGAGATAGAGAACGGCGACGGCAGCATCTAATCTGTGCCCGGCGAAGTAGATTAGGTTAGAATTAGG
ATTATAGAATTAGTACTATTAGTTAGAAAAAGATTCGTGAATACTGTACGTCTTTGAAAACAGTGCCCCTTGAGAAAATGAATATCTTAT
GGGTCCTGTTTGGCGCTTTTCATTTTCGAGAGCGGGTCCACTGCCAAACACACTACCAACTTCGTTCATTTCATTTATTAGTTACATGCA
TAAATACAAACGTTATTTTACAAACCAGTATCAACATACCCACCCAGCAGCAGTGTAATCCCATCACGTTTATGTTTGCCAAACAAAAGA
ATAAAATTATTCCTATCTAACAGAAGACATGATGTCCACATATAAATTGGGTCCAACGGTACCAGATCCATCTCTCCATTTATGCCATGG
CAATTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1461021.5e-1651 (11.2% of RFLP seq)-
SGN-U1481791.2e-72137 (30.0% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53897)
Chromosome
8
Position
78.80 cM
Confidence
uncalculated
Protocol
RFLP

Carotene_content_car8_12_Methylthio_ethanol_content_meo8_1Hex_3_en_1_ol_content_x3o8_1 2_Phenylethanal_content_pea8_1 3_Methylthio_propanal_content_mta8_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53340)
Chromosome
8
Position
97.45 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9695)
Chromosome
8
Position
90.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG496 was used as an overgo probe on plate 12 [well B5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATGGGTCCTGTTTGGCGCTTTTC
B sequence
ACCCGCTCTCGAAAATGAAAAGCG
AB sequence
TATGGGTCCTGTTTGGCGCTTTTCATTTTC
Marker sequence
TGGAAGTGAGAGATTTCATTGGCGGAGATAGAGAACGGCGACGGCAGCAT
CTAATCTGTGCCCGGCGAAGTAGATTAGGTTAGAATTAGGATTATAGAAT
TAGTACTATTAGTTAGAAAAAGATTCGTGAATACTGTACGTCTTTGAAAA
CAGTGCCCCTTGAGAAAATGAATATCTTATGGGTCCTGTTTGGCGCTTTT
CATTTTCGAGAGCGGGTCCACTGCCAAACACACTACCAACTTCGTTCATT
TCATTTATTAGTTACATGCATAAATACAAACGTTATTTTACAAACCAGTA
TCAACATACCCACCCAGCAGCAGTGTAATCCCATCACGTTTATGTTTGCC
AAACAAAAGAATAAAATTATTCCTATCTAACAGAAGACATGATGTCCACA
TATAAATTGGGTCCAACGGTACCAGATCCATCTCTCCATTTATGCCATGG
CAATTTG
Genomic location of TG496  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D641 marker 641
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)