SGN Marker C2_At1g02150

SGN-M6474
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U237419---
Solanum tuberosumSingleSGN-U254084---
ArabidopsisSingleAt1g02150 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46542)
Chromosome
1
Position
15.00 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46419)
Chromosome
1
Position
52.70 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38049)
Chromosome
1
Position
48.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39354
Forward primer (5'-3')
ACGAGGCTCTGTTAGTGTGTTGAATCAG
Accessions and product sizes
Solanum pennellii TA56
330
Solanum lycopersicum TA209
330
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCAACTTTTCAAAGTATTCTTCAGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
330
Solanum lycopersicum TA209
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24870)
Chromosome
1
Position
0.41 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9875
Forward primer (5'-3')
ACGAGGCTCTGTTAGTGTGTTGAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCAACTTTTCAAAGTATTCTTCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 9876
Forward primer (5'-3')
ACGAGGCTCTGTTAGTGTGTTGAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCAACTTTTCAAAGTATTCTTCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 9877
Forward primer (5'-3')
ACGAGGCTCTGTTAGTGTGTTGAATCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGGCAACTTTTCAAAGTATTCTTCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32184
Forward primer (5'-3')
ACGAGGCTCTGTTAGTGTGTTGAATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCAACTTTTCAAAGTATTCTTCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 9878
Forward primer (5'-3')
ACGAGGCTCTGTTAGTGTGTTGAATCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCAACTTTTCAAAGTATTCTTCAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: AflII,ApaLI,BanI,BsiHKAI,BslI,BsoBI,BstNI,DpnII,EcoO109I,HaeIII,HindIII,KpnI,MspI,NciI,RsaI,Sau96I,ScrFI,SmaI,StyI,TspRI,XcmI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g02150F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g02150  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6474 marker 6474
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)