SGN Marker C2_At1g02870

SGN-M6482
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303973 (SGN)
122867 (CGN)
---
Lycopersicon CombinedMultipleSGN-U218898---
Solanum tuberosumSingleSGN-U251098---
ArabidopsisSingleAt1g02870 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 24879)
Chromosome
1
Position
0.64 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 40981
Forward primer (5'-3')
TTCTCTTCCACCGAAGCTCCG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCTTCGTTTCTTCCCAAGTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
350
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 9891
Forward primer (5'-3')
TTCTCTTCCACCGAAGCTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTCGTTTCTTCCCAAGTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 9892
Forward primer (5'-3')
TTCTCTTCCACCGAAGCTCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTTCGTTTCTTCCCAAGTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1600
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g02870F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g02870  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6482 marker 6482
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)