SGN Marker C2_At1g02910

SGN-M6483
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204013---
Lycopersicon CombinedSingleSGN-U224518---
Solanum tuberosumSingleSGN-U262298---
ArabidopsisSingleAt1g02910 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109221)
Chromosome
9
Position
49.45 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38052)
Chromosome
9
Position
57.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39356
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
Accessions and product sizes
Solanum lycopersicum TA209
200
Solanum pennellii TA56
200
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24880)
Chromosome
1
Position
0.66 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9893
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1600
Approximate temperature
53°C
  
PCR data   Exp. ID 9894
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1600
Approximate temperature
53°C
  
PCR data   Exp. ID 9895
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1600
Approximate temperature
53°C
  
PCR data   Exp. ID 12369
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 12370
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1550+2100
Approximate temperature
55°C
  
PCR data   Exp. ID 12371
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12372
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1550
Approximate temperature
55°C
  
PCR data   Exp. ID 12373
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1550
Approximate temperature
55°C
  
PCR data   Exp. ID 32590
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1550
Approximate temperature
55°C
  
PCR data   Exp. ID 32672
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1550
Approximate temperature
55°C
  
PCR data   Exp. ID 32673
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1550
Approximate temperature
55°C
  
PCR data   Exp. ID 32674
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 9896
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
Digested band sizes (using DraI)
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HaeIII
  
Accessions and product sizes
Solanum pennellii LA716: 1600
Solanum lycopersicum LA925: 1600
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text

Genomic location of C2_At1g02910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6483 marker 6483
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)