SGN Marker C2_At1g03310

SGN-M6488
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307318 (SGN)
126845 (CGN)
---
Capsicum annuumSingleSGN-U202731---
Lycopersicon CombinedSingleSGN-U231874---
ArabidopsisSingleAt1g03310 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 24885)
Chromosome
1
Position
0.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 40983
Forward primer (5'-3')
ACGGAAAATTTATTCCCTCACTGG
Accessions and product sizes
Solanum pennellii TA56
460
Solanum lycopersicum TA209
460
Approximate temperature
53°C
Reverse primer (5'-3')
TGGGGAACCTCTGGAAGACTGACC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
460
Solanum lycopersicum TA209
210+250
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 32185
Forward primer (5'-3')
ACGGAAAATTTATTCCCTCACTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGGGGAACCTCTGGAAGACTGACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
53°C
  
PCR data   Exp. ID 32186
Forward primer (5'-3')
ACGGAAAATTTATTCCCTCACTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGGGGAACCTCTGGAAGACTGACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
53°C
  
PCR data   Exp. ID 32187
Forward primer (5'-3')
ACGGAAAATTTATTCCCTCACTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGGGGAACCTCTGGAAGACTGACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
53°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g03310  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6488 marker 6488
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)