SGN Marker C2_At1g04030

SGN-M6492
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308138 (SGN)
125863 (CGN)
---
Capsicum annuumSingleSGN-U200273---
Lycopersicon CombinedSingleSGN-U222951---
Solanum tuberosumSingleSGN-U253961---
ArabidopsisSingleAt1g04030 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 24889)
Chromosome
1
Position
1.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 40985
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 9906
Forward primer (5'-3')
ATACCAAACTCGACGAGCAAGTACAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTGTGGAGTGCCAATTAACTCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 9907
Forward primer (5'-3')
ATACCAAACTCGACGAGCAAGTACAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTGTGGAGTGCCAATTAACTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 9908
Forward primer (5'-3')
ATACCAAACTCGACGAGCAAGTACAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTGTGGAGTGCCAATTAACTCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12146
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 12147
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 12148
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12149
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12150
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 12151
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 12152
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 12153
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 12154
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12155
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12156
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12157
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33301
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 33302
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 33303
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 33304
Forward primer (5'-3')
ATAGGAGTGCTTACATCCATCCTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTACTTGCTCGTCGAGTTTGGTATG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 530
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g04030  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6492 marker 6492
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)