SGN Marker C2_At1g04190

SGN-M6494
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310991 (SGN)
128316 (CGN)
---
Lycopersicon CombinedSingleSGN-U218296---
Solanum tuberosumSingleSGN-U249830---
ArabidopsisSingleAt1g04190 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132170)
Chromosome
9
Position
92.88 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49198)
Chromosome
9
Position
63.66 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47128)
Chromosome
9
Position
65.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46544)
Chromosome
9
Position
47.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38057)
Chromosome
9
Position
72.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39360
Forward primer (5'-3')
TCATTTCTTCGACAGTATGCTGAAGATT
Accessions and product sizes
Solanum lycopersicum TA209
700
Solanum pennellii TA56
750
Approximate temperature
58°C
Reverse primer (5'-3')
ATTCCATCATTTTGTCCATGCTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24891)
Chromosome
1
Position
1.11 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g04190  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6494 marker 6494
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)