SGN Marker C2_At1g04530

SGN-M6497
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198605---
Lycopersicon CombinedMultipleSGN-U220574---
Solanum tuberosumSingleSGN-U253389---
ArabidopsisSingleAt1g04530 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46545)
Chromosome
9
Position
25.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46422)
Chromosome
9
Position
34.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41286)
Chromosome
3
Position
16.70 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43262
Forward primer (5'-3')
TAGCCCTCCCTTACATCTTGCAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTGTGGAGAAGCTTGTACTGCCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38058)
Chromosome
9
Position
94.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39361
Forward primer (5'-3')
TAGCCCTCCCTTACATCTTGCAGC
Accessions and product sizes
Solanum lycopersicum TA209
1400
Solanum pennellii TA56
1400
Approximate temperature
55°C
Reverse primer (5'-3')
TTGTGGAGAAGCTTGTACTGCCCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
950
Solanum lycopersicum TA209
1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24894)
Chromosome
1
Position
1.24 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 43723
Forward primer (5'-3')
TAGCCCTCCCTTACATCTTGCAGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTGTGGAGAAGCTTGTACTGCCCTC
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g04530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6497 marker 6497
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)