SGN Marker C2_At1g04970

SGN-M6505
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple306315 (SGN)
130075 (CGN)
---
Lycopersicon CombinedSingleSGN-U217419---
Solanum tuberosumSingleSGN-U248660---
ArabidopsisSingleAt1g04970 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46546)
Chromosome
7
Position
36.10 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46423)
Chromosome
7
Position
42.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38060)
Chromosome
7
Position
84.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39363
Forward primer (5'-3')
ATATCATTGGATATATCAAATAAAGGTC
Accessions and product sizes
Solanum pennellii TA56
550
Solanum lycopersicum TA209
550
Approximate temperature
55°C
Reverse primer (5'-3')
AGAAATTCCAACATCCATACCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
550
Solanum lycopersicum TA209
275
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24902)
Chromosome
1
Position
1.41 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g04970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6505 marker 6505
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)