SGN Marker C2_At1g05350

SGN-M6508
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U220877---
Solanum tuberosumSingleSGN-U258033---
ArabidopsisSingleAt1g05350 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38062)
Chromosome
3
Position
84.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39365
Forward primer (5'-3')
TGAACGAACCCTAAAGCGTGAAGG
Accessions and product sizes
Solanum pennellii TA56
250
Solanum lycopersicum TA209
250
Approximate temperature
53°C
Reverse primer (5'-3')
TCCGAACTTCAACAAGTACTTCAATGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24905)
Chromosome
1
Position
1.56 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9921
Forward primer (5'-3')
TGAACGAACCCTAAAGCGTGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGAACTTCAACAAGTACTTCAATGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 9922
Forward primer (5'-3')
TGAACGAACCCTAAAGCGTGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGAACTTCAACAAGTACTTCAATGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 9923
Forward primer (5'-3')
TGAACGAACCCTAAAGCGTGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGAACTTCAACAAGTACTTCAATGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 9924
Forward primer (5'-3')
TGAACGAACCCTAAAGCGTGAAGG
Digested band sizes (using DraI)
Solanum pennellii LA716: 340
Solanum lycopersicum LA925: 530
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCGAACTTCAACAAGTACTTCAATGTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,AseI,DraI,TspRI
All possible enzymes for lycopersicum and pimpinellifolium: ApoI
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Solanum pennellii LA716: 530
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g05350F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g05350F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g05350  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6508 marker 6508
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)