SGN Marker CT138

SGN-M651

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
TTTTTTTTTTTTTGCACAATATTTCTATGTTTTGTAATTATTTGAAAAAGTAGAGACACAAGAAAGTGCAATTTTGAAGACTAATAAAGC
AGATATTCCTCAACAATACAAAGTATAGGGAGTATTGGCCTGTTGCCCAATTCAATCTGAAAACGAATATGATTGTGGTGCTTTTGAGAT
TTACCATCGTTCACCTCCTCCATATTACAAAATACAGAACCTCAAGGCATTTACTATCCACAAATATTTAATGATGATACTACTAATTTG
CTAAGGAAATGGTACGCGATAGCCTGACAAGAATAAAGTTACAAGAATTTAATCAGAAAACTATCTAGTCACCGTGGCATGAAAGCCTCT
TGAACGGAACACAACCAGCATCCTTCACATGCAAGGCGGCTAAGCGAATGGCATAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U148292350 (84.1% of RFLP seq)-
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42951)
Chromosome
5
Position
49.80 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43951
Forward primer (5'-3')
CTCAGGCGTCGGAATCAAAG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CAAGAGCAAACTGAACCTGAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42299)
Chromosome
5
Position
60.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38974)
Chromosome
5
Position
119.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9721)
Chromosome
5
Position
130.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9723)
Chromosome
5
Position
61.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9722)
Chromosome
5
Position
95.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT138 was used as an overgo probe on plate 5 [well C6]

Plausible BAC Matches:   P076P16,   P056N10

 Overgo Sequences

A sequence
GCATGAAAGCCTCTTGAACGGAAC
B sequence
GAAGGATGCTGGTTGTGTTCCGTT
AB sequence
GCATGAAAGCCTCTTGAACGGAACACAACC
Marker sequence
TTTTTTTTTTTTTGCACAATATTTCTATGTTTTGTAATTATTTGAAAAAG
TAGAGACACAAGAAAGTGCAATTTTGAAGACTAATAAAGCAGATATTCCT
CAACAATACAAAGTATAGGGAGTATTGGCCTGTTGCCCAATTCAATCTGA
AAACGAATATGATTGTGGTGCTTTTGAGATTTACCATCGTTCACCTCCTC
CATATTACAAAATACAGAACCTCAAGGCATTTACTATCCACAAATATTTA
ATGATGATACTACTAATTTGCTAAGGAAATGGTACGCGATAGCCTGACAA
GAATAAAGTTACAAGAATTTAATCAGAAAACTATCTAGTCACCGTGGCAT
GAAAGCCTCTTGAACGGAACACAACCAGCATCCTTCACATGCAAGGCGGC
TAAGCGAATGGCATAA
Genomic location of CT138  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D651 marker 651
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)