SGN Marker C2_At1g06550

SGN-M6524
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197535---
Lycopersicon CombinedMultipleSGN-U220947---
Solanum tuberosumSingleSGN-U246779---
ArabidopsisSingleAt1g06550 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38067)
Chromosome
12
Position
47.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40998
Forward primer (5'-3')
AATCTCAATGGGCGGAGGTGCATC
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
TCGCTCCAGTTAAACCCAAGTATTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
525
Solanum lycopersicum TA209
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24921)
Chromosome
1
Position
2.01 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g06550  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6524 marker 6524
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)