SGN Marker C2_At1g07310

SGN-M6533
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303051 (SGN)
122261 (CGN)
---
Capsicum annuumSingleSGN-U197069---
Lycopersicon CombinedSingleSGN-U238037---
Solanum tuberosumSingleSGN-U249280---
ArabidopsisSingleAt1g07310 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46549)
Chromosome
3
Position
9.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46424)
Chromosome
3
Position
27.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41291)
Chromosome
3
Position
28.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43267
Forward primer (5'-3')
TTGTAGTTATTATTACTCTACTGCCCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTGTAGAGCGGCAATCTAGCTATGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38071)
Chromosome
9
Position
74.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41002
Forward primer (5'-3')
AGAAAACCTACGATCTCGAAATCACC
Accessions and product sizes
Solanum lycopersicum TA209
600
Solanum pennellii TA56
600
Approximate temperature
55°C
Reverse primer (5'-3')
AAACTGCCATAGCTAGATTGCCG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
400
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24931)
Chromosome
1
Position
2.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 43725
Forward primer (5'-3')
AGAAAACCTACGATCTCGAAATCACC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAACTGCCATAGCTAGATTGCCG
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g07310  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6533 marker 6533
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)