SGN Marker C2_At1g09070

SGN-M6554
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198900---
Solanum tuberosumSingleSGN-U248519---
ArabidopsisSingleAt1g09070 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46550)
Chromosome
1
Position
48.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46425)
Chromosome
1
Position
37.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41293)
Chromosome
1
Position
208.00 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43269
Forward primer (5'-3')
GAGATGTTCAATCAGGAGACTTCTAGTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CGGTGGATATCCGTACCCAGGTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38077)
Chromosome
1
Position
110.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41011
Forward primer (5'-3')
ATGGAGTTACGTCCTTTAGACATCAAA
Accessions and product sizes
Solanum lycopersicum TA209
275
Solanum pennellii TA56
275
Approximate temperature
55°C
Reverse primer (5'-3')
CGGTGGATATCCGTACCCAGGTTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150
Solanum lycopersicum TA209
225
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24952)
Chromosome
1
Position
2.93 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g09070  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6554 marker 6554
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)