SGN Marker C2_At1g09340

SGN-M6559
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301134 (SGN)
123722 (CGN)
---
Lycopersicon CombinedSingleSGN-U213740---
Solanum tuberosumMultipleSGN-U244061---
ArabidopsisSingleAt1g09340 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38078)
Chromosome
6
Position
67.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39375
Forward primer (5'-3')
ATCCTGTTGAAGAGTGGTTCTTCC
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCGCAAGCCTTAGCTAATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
400
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24957)
Chromosome
1
Position
3.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9965
Forward primer (5'-3')
ATCCTGTTGAAGAGTGGTTCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGCAAGCCTTAGCTAATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 9966
Forward primer (5'-3')
ATCCTGTTGAAGAGTGGTTCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGCAAGCCTTAGCTAATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 9967
Forward primer (5'-3')
ATCCTGTTGAAGAGTGGTTCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGCAAGCCTTAGCTAATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 9968
Forward primer (5'-3')
ATCCTGTTGAAGAGTGGTTCTTCC
Digested band sizes (using ScaI)
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGCAAGCCTTAGCTAATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: ScaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g09340F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At1g09340  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6559 marker 6559
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)