SGN Marker C2_At1g11430

SGN-M6580
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310746 (SGN)
131040 (CGN)
---
Lycopersicon CombinedMultipleSGN-U215670---
Solanum tuberosumSingleSGN-U245889---
ArabidopsisSingleAt1g11430 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132172)
Chromosome
2
Position
64.17 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46553)
Chromosome
2
Position
6.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46427)
Chromosome
2
Position
4.80 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42166)
Chromosome
2
Position
54.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43729
Forward primer (5'-3')
AGTTCCCTAAAGACCCTGCTCCTAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACTAAAGGCATACATGTTCTTCTTTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41297)
Chromosome
2
Position
81.00 cM
Confidence
I(LOD2)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43273
Forward primer (5'-3')
CTGTATGATATGATTCTGGTGATTTTTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACTAAAGGCATACATGTTCTTCTTTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38089)
Chromosome
2
Position
70.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39383
Forward primer (5'-3')
AGTTCCCTAAAGACCCTGCTCCTAC
Accessions and product sizes
Solanum pennellii TA56
2400
Solanum lycopersicum TA209
2400
Approximate temperature
55°C
Reverse primer (5'-3')
ACTAAAGGCATACATGTTCTTCTTTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24979)
Chromosome
1
Position
3.85 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9995
Forward primer (5'-3')
AGTTCCCTAAAGACCCTGCTCCTAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAAAGGCATACATGTTCTTCTTTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 9996
Forward primer (5'-3')
AGTTCCCTAAAGACCCTGCTCCTAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAAAGGCATACATGTTCTTCTTTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 9997
Forward primer (5'-3')
AGTTCCCTAAAGACCCTGCTCCTAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAAAGGCATACATGTTCTTCTTTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 9998
Forward primer (5'-3')
AGTTCCCTAAAGACCCTGCTCCTAC
Digested band sizes (using RsaI)
Solanum pennellii LA716: 410
Solanum lycopersicum LA925: 480
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAAAGGCATACATGTTCTTCTTTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AvaII,BslI,RsaI,Sau96I,SsPI,TspRI
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g11430F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g11430F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g11430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6580 marker 6580
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)