SGN Marker C2_At1g11440

SGN-M6581
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308970 (SGN)
125818 (CGN)
---
Lycopersicon CombinedSingleSGN-U219904---
ArabidopsisSingleAt1g11440 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38090)
Chromosome
2
Position
70.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41022
Forward primer (5'-3')
TCCTAATTTTAATGTCTCTTATGATTATG
Accessions and product sizes
Solanum lycopersicum TA209
425
Solanum pennellii TA56
425
Approximate temperature
55°C
Reverse primer (5'-3')
ATTAGACTTGAGGGTCGAACGAGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300
Solanum pennellii TA56
425
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24980)
Chromosome
1
Position
3.85 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g11440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6581 marker 6581
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)