SGN Marker C2_At1g11600

SGN-M6582
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309944 (SGN)
130067 (CGN)
---
Capsicum annuumSingleSGN-U204259---
Lycopersicon CombinedMultipleSGN-U221197---
Solanum tuberosumSingleSGN-U258693---
ArabidopsisSingleAt1g11600 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109223)
Chromosome
2
Position
57.61 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38091)
Chromosome
2
Position
70.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41023
Forward primer (5'-3')
ACACCCTTGTTTCGCAGCCAAGTG
Accessions and product sizes
Solanum lycopersicum TA209
1050
Solanum pennellii TA56
1050
Approximate temperature
55°C
Reverse primer (5'-3')
TCAAACTTAGATCCTTGGCAAAATAATTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
625425
Solanum lycopersicum TA209
1050
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24981)
Chromosome
1
Position
3.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g11600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6582 marker 6582
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)