SGN Marker C2_At1g12060

SGN-M6588
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202287---
Lycopersicon CombinedSingleSGN-U218543---
ArabidopsisSingleAt1g12060 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46554)
Chromosome
8
Position
77.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38093)
Chromosome
6
Position
64.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39385
Forward primer (5'-3')
ATCGGTCCCAGTCAGCTCGCC
Accessions and product sizes
Solanum pennellii TA56
650
Solanum lycopersicum TA209
650
Approximate temperature
55°C
Reverse primer (5'-3')
AGCGTCTCATTCACCCGCAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
650
Solanum lycopersicum TA209
375
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24987)
Chromosome
1
Position
4.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g12060  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6588 marker 6588
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)