SGN Marker C2_At1g12410

SGN-M6594
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301797 (SGN)
123256 (CGN)
---
Capsicum annuumSingleSGN-U200944---
Lycopersicon CombinedSingleSGN-U214597---
Solanum tuberosumSingleSGN-U244768---
ArabidopsisSingleAt1g12410 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 24993)
Chromosome
1
Position
4.22 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41026
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
130
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10008
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10009
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10010
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12389
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12390
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12391
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12392
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12393
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12394
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12395
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12396
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 300+550
Approximate temperature
55°C
  
PCR data   Exp. ID 12397
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12398
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 12399
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 12400
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 32683
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32684
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32685
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32686
Forward primer (5'-3')
ATGTTTATCAATGGGCCTGGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGATTGTAGGCAAAGCCCACAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g12410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6594 marker 6594
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)