SGN Marker C2_At1g13690

SGN-M6599
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198897---
Lycopersicon CombinedSingleSGN-U226992---
Solanum tuberosumSingleSGN-U250263---
ArabidopsisSingleAt1g13690 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 24999)
Chromosome
1
Position
4.69 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41027
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
Accessions and product sizes
Solanum pennellii TA56
150
Solanum lycopersicum TA209
150
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10015
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 10016
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 10017
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 12158
Forward primer (5'-3')
TCTGTACGTAGGAGGATTAGCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGCTTCAGCCGTTGCCATAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12159
Forward primer (5'-3')
TCTGTACGTAGGAGGATTAGCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGCTTCAGCCGTTGCCATAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12160
Forward primer (5'-3')
TCTGTACGTAGGAGGATTAGCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGCTTCAGCCGTTGCCATAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12161
Forward primer (5'-3')
TCTGTACGTAGGAGGATTAGCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGCTTCAGCCGTTGCCATAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12415
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12416
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12417
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12418
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12419
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12420
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12421
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12422
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12423
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32199
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
40mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 32200
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
40mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 32201
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
40mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 32691
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32692
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32693
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32694
Forward primer (5'-3')
TGGTGAACAGGGTTGGGCTGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGTTGCCTCTCAAACCATGTGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33305
Forward primer (5'-3')
TCTGTACGTAGGAGGATTAGCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGCTTCAGCCGTTGCCATAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33306
Forward primer (5'-3')
TCTGTACGTAGGAGGATTAGCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGCTTCAGCCGTTGCCATAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g13690  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6599 marker 6599
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)