SGN Marker C2_At1g14300

SGN-M6605
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U222377---
Solanum tuberosumSingleSGN-U246171---
ArabidopsisSingleAt1g14300 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38099)
Chromosome
5
Position
20.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39391
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
53°C
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25006)
Chromosome
1
Position
4.88 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10025
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10026
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10027
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12435
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12436
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12437
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12438
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12439
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12440
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12441
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12442
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12443
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12444
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12445
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12446
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12447
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12448
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32699
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32700
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32701
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32702
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 10028
Forward primer (5'-3')
AGGCGCTAGAGGCTATTTATTTGC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACTGACCAAAATGCTCTTCTGCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g14300  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6605 marker 6605
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)