SGN Marker C2_At1g14790

SGN-M6609
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304140 (SGN)
123565 (CGN)
---
Lycopersicon CombinedSingleSGN-U217771---
Solanum tuberosumSingleSGN-U248109---
ArabidopsisSingleAt1g14790 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46556)
Chromosome
12
Position
22.30 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41300)
Chromosome
11
Position
40.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43276
Forward primer (5'-3')
TGGAGAGAACACTAATATTCTCAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATGTCTTGATCCCAGCAAACAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38101)
Chromosome
5
Position
19.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39393
Forward primer (5'-3')
TGGAGAGAACACTAATATTCTCAAGG
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
ATGTCTTGATCCCAGCAAACAAAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25011)
Chromosome
1
Position
5.10 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g14790  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6609 marker 6609
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)