SGN Marker C2_At1g14810

SGN-M6610
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308388 (SGN)
132120 (CGN)
---
Lycopersicon CombinedSingleSGN-U221433---
Solanum tuberosumSingleSGN-U256556---
ArabidopsisSingleAt1g14810 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49200)
Chromosome
1
Position
0.19 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47130)
Chromosome
1
Position
3.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42167)
Chromosome
1
Position
31.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43730
Forward primer (5'-3')
ACATGTATACGTGTTCCTGTTATGCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGGAATCTATTACTTGCACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41301)
Chromosome
1
Position
157.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43277
Forward primer (5'-3')
ACATGTATACGTGTTCCTGTTATGCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGGAATCTATTACTTGCACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38102)
Chromosome
1
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39394
Forward primer (5'-3')
ACATGTATACGTGTTCCTGTTATGCG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGGGAATCTATTACTTGCACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25012)
Chromosome
1
Position
5.10 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g14810  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6610 marker 6610
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)