SGN Marker C2_At1g16080

SGN-M6624
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202022---
Solanum tuberosumSingleSGN-U250484---
ArabidopsisSingleAt1g16080 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132174)
Chromosome
3
Position
109.29 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Eggplant-COSII   
Map version
63 (location: 42168)
Chromosome
3
Position
134.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43731
Forward primer (5'-3')
TTTGAAAGGTTAGGTTGCACTATTCAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGACGCAGTCTCCAGCAGCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41302)
Chromosome
3
Position
129.70 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43278
Forward primer (5'-3')
TGTCAAAACTGATTGCTGAGCTTGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGCCTTCTCAGAGAGTGAATAGAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38105)
Chromosome
3
Position
132.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41036
Forward primer (5'-3')
TGTCAAAACTGATTGCTGAGCTTGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ATTGCCTTCTCAGAGAGTGAATAGAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25026)
Chromosome
1
Position
5.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g16080  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6624 marker 6624
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)