SGN Marker C2_At1g16210

SGN-M6626
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301919 (SGN)
123394 (CGN)
---
Capsicum annuumSingleSGN-U196844---
Lycopersicon CombinedSingleSGN-U223909---
Solanum tuberosumMultipleSGN-U247591---
ArabidopsisSingleAt1g16210 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38107)
Chromosome
1
Position
165.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39398
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25028)
Chromosome
1
Position
5.55 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10046
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10047
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10048
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12162
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12163
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12164
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12165
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12166
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12167
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12168
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12169
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12170
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12171
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12459
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12460
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 400+900
Approximate temperature
55°C
  
PCR data   Exp. ID 12461
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 12462
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 12463
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12464
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12465
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12466
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12467
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 400+900
Approximate temperature
55°C
  
PCR data   Exp. ID 32708
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 32709
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 32710
Forward primer (5'-3')
AGGAAGGAGGCGGAGCAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTCAGAGCACGAAGCTCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33307
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33308
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750+1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33309
Forward primer (5'-3')
AAAGCCGAGACGTCTAGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGAGGATTATCTGGAGATTTCTTCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At1g16210F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g16210  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6626 marker 6626
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)