SGN Marker C2_At1g16590

SGN-M6632
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311291 (SGN)
130493 (CGN)
---
Lycopersicon CombinedSingleSGN-U236356---
ArabidopsisSingleAt1g16590 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41304)
Chromosome
3
Position
0.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43280
Forward primer (5'-3')
ATTCTTCTGTCAATGGACTTCTTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTGCCACTCTCTCAACCAATCCCTGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38108)
Chromosome
9
Position
112.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39399
Forward primer (5'-3')
ATTCTTCTGTCAATGGACTTCTTCC
Accessions and product sizes
Solanum lycopersicum TA209
1800
Solanum pennellii TA56
1800
Approximate temperature
58°C
Reverse primer (5'-3')
TTACATTTATCTTGAAAACAAATCTCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1700
Solanum lycopersicum TA209
1800
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25034)
Chromosome
1
Position
5.67 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g16590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6632 marker 6632
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)