SGN Marker C2_At1g16900

SGN-M6636
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306380 (SGN)
130130 (CGN)
---
Solanum tuberosumSingleSGN-U266827---
ArabidopsisSingleAt1g16900 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46559)
Chromosome
7
Position
15.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38110)
Chromosome
7
Position
62.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39401
Forward primer (5'-3')
TGTCTCCCACGCTCGGACATTTTC
Accessions and product sizes
Solanum lycopersicum TA209
1300
Solanum pennellii TA56
1300
Approximate temperature
58°C
Reverse primer (5'-3')
AAGAAGGGAACCGGTGCCACTCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
775
Solanum pennellii TA56
1300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25038)
Chromosome
1
Position
5.78 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g16900  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6636 marker 6636
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)