SGN Marker C2_At1g17130

SGN-M6638
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302808 (SGN)
121088 (CGN)
---
Lycopersicon CombinedSingleSGN-U219757---
Solanum tuberosumSingleSGN-U247582---
ArabidopsisSingleAt1g17130 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38111)
Chromosome
8
Position
36.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39402
Forward primer (5'-3')
AACTAGGAATTTTGAGCCTTGGCG
Accessions and product sizes
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TTCATTGCATCACCCATTTCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25040)
Chromosome
1
Position
5.86 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10052
Forward primer (5'-3')
ACAGCCGAAGAATCAGCAGATGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTGGGGTCTGTCTTGTAAGTAATCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10053
Forward primer (5'-3')
ACAGCCGAAGAATCAGCAGATGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTGGGGTCTGTCTTGTAAGTAATCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 32203
Forward primer (5'-3')
ACAGCCGAAGAATCAGCAGATGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTGGGGTCTGTCTTGTAAGTAATCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text

Genomic location of C2_At1g17130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6638 marker 6638
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)