SGN Marker C2_At1g17410

SGN-M6642
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300471 (SGN)
122339 (CGN)
---
Lycopersicon CombinedSingleSGN-U242450---
Solanum tuberosumSingleSGN-U252417---
ArabidopsisSingleAt1g17410 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49201)
Chromosome
12
Position
46.36 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47131)
Chromosome
12
Position
58.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46560)
Chromosome
12
Position
56.50 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41306)
Chromosome
12
Position
63.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43282
Forward primer (5'-3')
AATGCCATAGCTGATTGGCGT
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
GGTGAGTCAGAACCATGAACACAATT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38113)
Chromosome
12
Position
64.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39403
Forward primer (5'-3')
ATTGGCTATAATAAAGCCAGATGG
Accessions and product sizes
Solanum pennellii TA56
900
Solanum lycopersicum TA209
900
Approximate temperature
55°C
Reverse primer (5'-3')
AATTAATGCACGCCAATCAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
375
Solanum pennellii TA56
675
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25044)
Chromosome
1
Position
5.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g17410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6642 marker 6642
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)