SGN Marker C2_At1g18270

SGN-M6649
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310536 (SGN)
131158 (CGN)
---
Lycopersicon CombinedSingleSGN-U239683---
ArabidopsisSingleAt1g18270 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41307)
Chromosome
3
Position
131.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43283
Forward primer (5'-3')
ACCTCATCAGATCTTGCCACAAAAGC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
AGCAACAACTGCCTCAACTCCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38114)
Chromosome
3
Position
140.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39404
Forward primer (5'-3')
ACCTCATCAGATCTTGCCACAAAAGC
Accessions and product sizes
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1100
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAACAACTGCCTCAACTCCTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
800
Solanum pennellii TA56
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25051)
Chromosome
1
Position
6.29 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g18270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6649 marker 6649
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)