SGN Marker C2_At1g18660

SGN-M6656
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308806 (SGN)
128970 (CGN)
---
Lycopersicon CombinedSingleSGN-U223505---
Solanum tuberosumSingleSGN-U253148---
ArabidopsisSingleAt1g18660 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42170)
Chromosome
3
Position
126.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43733
Forward primer (5'-3')
ACCCTGTGCTTAAAGTTATTATATGAACC
Accessions and product sizes
Approximate temperature
50°C
Reverse primer (5'-3')
ACTGTTCGGCACAATGGACATCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41309)
Chromosome
3
Position
123.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43285
Forward primer (5'-3')
ACCCTGTGCTTAAAGTTATTATATGAACC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ACTGTTCGGCACAATGGACATCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38117)
Chromosome
3
Position
112.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39406
Forward primer (5'-3')
ACCCTGTGCTTAAAGTTATTATATGAACC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACTGTTCGGCACAATGGACATCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25058)
Chromosome
1
Position
6.42 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g18660  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6656 marker 6656
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)