SGN Marker C2_At1g19130

SGN-M6659
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301286 (SGN)
124372 (CGN)
---
Capsicum annuumSingleSGN-U197463---
Lycopersicon CombinedMultipleSGN-U222483---
Solanum tuberosumSingleSGN-U265747---
ArabidopsisSingleAt1g19130 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132175)
Chromosome
12
Position
30.23 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38118)
Chromosome
12
Position
33.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41048
Forward primer (5'-3')
ACCTGTCAGTACATGCATCTACTTCTTGC
Accessions and product sizes
Solanum lycopersicum TA209
700
Solanum pennellii TA56
700
Approximate temperature
55°C
Reverse primer (5'-3')
ATACATTTGGAGGTACTGTATACTGCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25061)
Chromosome
1
Position
6.61 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g19130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6659 marker 6659
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)