SGN Marker CT269

SGN-M666

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT269 image not available
Forward sequence
TTTTTTTTTTTTTTAAACATGTAAGCACACTTAGTGTCGGTCTGCATAAGAAAAAATATCCATATCCTTTTACTAGTAACCTACCCACTT
ATCACAAGATAGCAAATGCCAAATTACTGCTGTGCACATTGGACTCTCTGTGCACCACCAGGCATATCATCATCTTCGTCATATGCCTCT
TGGGCAGCTTGCTGCTTCCTTCGCATCTCATCCTCAATGTTCACATCGTGCAAAGTAGTCTCCTCACACTCGTCTAATTCCATATCAGAT
ACTTGCAATTTGAGGTTTTGGAGGCAGCACAGCCTCAAGGTTCTTGCACTGCTCTGCTGTTAATGACTCGGGGAAATCAACAGTGAAGTG
AATGTACATTTTACCTCCTCATGAACGGCCTTTGGTACATCGGCATTCCTTCATCGTTGATAGCCTTAAACTGATCAGGCTTGACAACTT
CGCCAGGTTGGGACTTAATGAGCAGCTGTCTGTTTGTCTAGGTGAGTCAAGACAAACTGGAAACCACATAGGGCCTCAGTCAAGGGTCAA
TGTGTGCTCAACAAAAAGATCATCTCCCTTTCGCTTGAACTTAGGATGTTCCTTTTGTTGCA
Reverse sequence
TTTTTTTTTTTTTTAAACATGTAAGCACACTTAGTGTCGGTCTGCATAAGAAAAAATATCCATATCCTTTTACTAGTAACCTACCCACTT
ATCACAAGATAGCAAATGCCAAATTACTGCTGTGCACATTGGACTCTCTGTGCACCACCAGGCATATCATCATCTTCGTCATATGCCTCT
TGGGCAGCTTGCTGCTTCCTTCGCATCTCATCCTCAATGTTCACATCGTGCAAAGTAGTCTCCTCACACTCGTCTAATTCCATATCAGAT
ACTTGCAATTTGGGTTTTGGAGGCAGCACAGCCTCAAGGTTCTTGCACTGCTCTGCTGTTAATGACTCGGGGAAATCAACAGTGAAGTGA
ATGTACATTTTACCTCTCATGAACGGCCTTTGGTACATCGGCATTCCTTCATCGTTGATAGCCTTAAACTGATCAGGCTTGACAACTTCG
CCAGGTTGGGACTTAATGAGCAGCTGTCTGTTGTCTAGGTGAGTCAAGACAAACTGGAAACCACATAGGGCCTCAGTCAAGGTCAATGTG
TGCTCAACAAAAAGATCATCTCCCTTTCGCTTGAACTTAGGATGTTCCTTTTGTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1603452.7e-0642 (7.0% of RFLP seq)+
SGN-U1470434.6e-1178 (13.0% of RFLP seq)+
SGN-U1470431.2e-14104 (17.3% of RFLP seq)+
SGN-U1603462e-56362 (60.1% of RFLP seq)+
SGN-U1603431.2e-85175 (29.1% of RFLP seq)+
SGN-U1431904.8e-88497 (82.6% of RFLP seq)+
SGN-U1431891.4e-97499 (82.9% of RFLP seq)+
SGN-U143187588 (97.7% of RFLP seq)+
SGN-U1603452.7e-0642 (7.0% of RFLP seq)-
SGN-U1470438.9e-28226 (37.9% of RFLP seq)-
SGN-U1603461.6e-72385 (64.6% of RFLP seq)-
SGN-U1603438e-93171 (28.7% of RFLP seq)-
SGN-U1431901e-103491 (82.4% of RFLP seq)-
SGN-U1431891e-110493 (82.7% of RFLP seq)-
SGN-U143187582 (97.7% of RFLP seq)-
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49341)
Chromosome
11
Position
1.15 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47278)
Chromosome
11
Position
14.41 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39044)
Chromosome
11
Position
6.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9769)
Chromosome
11
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9768)
Chromosome
4
Position
21.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT269 was used as an overgo probe on plate 3 [well D5]

Plausible BAC Matches:   P041E17,   P149I14,   P277A14

 Overgo Sequences

A sequence
CCACCAGGCATATCATCATCTTCG
B sequence
CCCAAGAGGCATATGACGAAGATG
AB sequence
CCACCAGGCATATCATCATCTTCGTCATAT
Marker sequence
TTTTTTTTTTTTTTAAACATGTAAGCACACTTAGTGTCGGTCTGCATAAG
AAAAAATATCCATATCCTTTTACTAGTAACCTACCCACTTATCACAAGAT
AGCAAATGCCAAATTACTGCTGTGCACATTGGACTCTCTGTGCACCACCA
GGCATATCATCATCTTCGTCATATGCCTCTTGGGCAGCTTGCTGCTTCCT
TCGCATCTCATCCTCAATGTTCACATCGTGCAAAGTAGTCTCCTCACACT
CGTCTAATTCCATATCAGATACTTGCAATTTGAGGTTTTGGAGGCAGCAC
AGCCTCAAGGTTCTTGCACTGCTCTGCTGTTAATGACTCGGGGAAATCAA
CAGTGAAGTGAATGTACATTTTACCTCCTCATGAACGGCCTTTGGTACAT
CGGCATTCCTTCATCGTTGATAGCCTTAAACTGATCAGGCTTGACAACTT
CGCCAGGTTGGGACTTAATGAGCAGCTGTCTGTTTGTCTAGGTGAGTCAA
GACAAACTGGAAACCACATAGGGCCTCAGTCAAGGGTCAATGTGTGCTCA
ACAAAAAGATCATCTCCCTTTCGCTTGAACTTAGGATGTTCCTTTTGTTG
CA
Genomic location of CT269  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D666 marker 666
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)