SGN Marker C2_At1g19340

SGN-M6660
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302227 (SGN)
124101 (CGN)
---
Lycopersicon CombinedSingleSGN-U226686---
ArabidopsisSingleAt1g19340 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46562)
Chromosome
4
Position
78.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42171)
Chromosome
4
Position
106.10 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43734
Forward primer (5'-3')
ACCTAAAACTGTCAGTTGAAGAACAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATAAGAAGTATCGGCTAGGCAAAGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38120)
Chromosome
4
Position
112.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39408
Forward primer (5'-3')
AATGTGATTGTGGCTTCAATCTCAT
Accessions and product sizes
Solanum lycopersicum TA209
425
Solanum pennellii TA56
425
Approximate temperature
55°C
Reverse primer (5'-3')
ATAAGAAGTATCGGCTAGGCAAAGT
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
225
Solanum pennellii TA56
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25063)
Chromosome
1
Position
6.69 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g19340  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6660 marker 6660
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)