SGN Marker C2_At1g19530

SGN-M6662
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304335 (SGN)
124322 (CGN)
---
Capsicum annuumSingleSGN-U203092---
Lycopersicon CombinedSingleSGN-U213689---
Solanum tuberosumMultipleSGN-U243848---
ArabidopsisSingleAt1g19530 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25065)
Chromosome
1
Position
6.76 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41049
Forward primer (5'-3')
AAACAGGCGAATATTGTATTTGAGG
Accessions and product sizes
Solanum lycopersicum TA209
200
Solanum pennellii TA56
200
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCATGTTGGCTACGTGAAATTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10061
Forward primer (5'-3')
AAACAGGCGAATATTGTATTTGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATGTTGGCTACGTGAAATTGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 10062
Forward primer (5'-3')
AAACAGGCGAATATTGTATTTGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATGTTGGCTACGTGAAATTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32204
Forward primer (5'-3')
AAACAGGCGAATATTGTATTTGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCATGTTGGCTACGTGAAATTGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g19530F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text

Genomic location of C2_At1g19530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6662 marker 6662
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)