SGN Marker C2_At1g21690

SGN-M6677
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200035---
Lycopersicon CombinedSingleSGN-U227461---
Solanum tuberosumSingleSGN-U258705---
ArabidopsisSingleAt1g21690 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49203)
Chromosome
11
Position
5.61 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47134)
Chromosome
11
Position
61.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46566)
Chromosome
4
Position
45.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41313)
Chromosome
12
Position
96.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43289
Forward primer (5'-3')
ATGCAGAGCTCTCAGCCATGGG
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
ACCTACAGCAACAGCAGCAAAGTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38129)
Chromosome
11
Position
40.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39417
Forward primer (5'-3')
ATGCAGAGCTCTCAGCCATGGG
Accessions and product sizes
Solanum pennellii TA56
160
Solanum lycopersicum TA209
160
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTACAGCAACAGCAGCAAAGTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25081)
Chromosome
1
Position
7.62 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10071
Forward primer (5'-3')
ATGCAGAGCTCTCAGCCATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTACAGCAACAGCAGCAAAGTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1450
Approximate temperature
55°C
  
PCR data   Exp. ID 10072
Forward primer (5'-3')
ATGCAGAGCTCTCAGCCATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTACAGCAACAGCAGCAAAGTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1550
Approximate temperature
55°C
  
PCR data   Exp. ID 10073
Forward primer (5'-3')
ATGCAGAGCTCTCAGCCATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTACAGCAACAGCAGCAAAGTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1450
Approximate temperature
55°C
  
PCR data   Exp. ID 32205
Forward primer (5'-3')
ATGCAGAGCTCTCAGCCATGGG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1450
Solanum lycopersicum LA925: 1550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTACAGCAACAGCAGCAAAGTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 1450
Solanum lycopersicum LA925: 1550
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g21690  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6677 marker 6677
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)