SGN Marker C2_At1g21760

SGN-M6680
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304289 (SGN)
120240 (CGN)
---
Lycopersicon CombinedSingleSGN-U235893---
Solanum tuberosumSingleSGN-U246042---
ArabidopsisSingleAt1g21760 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25084)
Chromosome
1
Position
7.65 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41050
Forward primer (5'-3')
ACTACCTGATGAACTGCTTTTTGAG
Accessions and product sizes
Solanum pennellii TA56
1650
Solanum lycopersicum TA209
1650
Approximate temperature
55°C
Reverse primer (5'-3')
ACTTTCGACAAACACAAGCTGCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10074
Forward primer (5'-3')
ACTACCTGATGAACTGCTTTTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTTCGACAAACACAAGCTGCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10075
Forward primer (5'-3')
ACTACCTGATGAACTGCTTTTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTTCGACAAACACAAGCTGCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10076
Forward primer (5'-3')
ACTACCTGATGAACTGCTTTTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTTCGACAAACACAAGCTGCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 12501
Forward primer (5'-3')
ACTACCTGATGAACTGCTTTTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTTCGACAAACACAAGCTGCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 12502
Forward primer (5'-3')
ACTACCTGATGAACTGCTTTTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTTCGACAAACACAAGCTGCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 12503
Forward primer (5'-3')
ACTACCTGATGAACTGCTTTTTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTTTCGACAAACACAAGCTGCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g21760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6680 marker 6680
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)