SGN Marker C2_At1g23740

SGN-M6692
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301070 (SGN)
121897 (CGN)
---
Capsicum annuumSingleSGN-U204056---
Lycopersicon CombinedMultipleSGN-U213459---
Solanum tuberosumSingleSGN-U246571---
ArabidopsisSingleAt1g23740 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25097)
Chromosome
1
Position
8.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41056
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
Accessions and product sizes
Solanum lycopersicum TA209
1350
Solanum pennellii TA56
1350
Approximate temperature
55°C
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10087
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10088
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 10089
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12514
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12515
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 12516
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12517
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12518
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12519
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12520
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12521
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12522
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12523
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32596
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32729
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32730
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32731
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32732
Forward primer (5'-3')
TGAAGTTGGAGTCCAATGTTGCAG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACCGCCAGCACCTCCCAAAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 950
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g23740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6692 marker 6692
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)