SGN Marker C2_At1g24360

SGN-M6697
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304179 (SGN)
124136 (CGN)
---
Lycopersicon CombinedSingleSGN-U214155---
Solanum tuberosumMultipleSGN-U244526---
ArabidopsisSingleAt1g24360 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46569)
Chromosome
12
Position
27.40 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41315)
Chromosome
6
Position
103.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43291
Forward primer (5'-3')
TCCGGTTGTTATTGTCACTGGAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGAAACTTCTTCTGCCTCCTTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38134)
Chromosome
6
Position
62.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39422
Forward primer (5'-3')
TCCGGTTGTTATTGTCACTGGAGC
Accessions and product sizes
Solanum pennellii TA56
850
Solanum lycopersicum TA209
850
Approximate temperature
55°C
Reverse primer (5'-3')
TGGAAACTTCTTCTGCCTCCTTTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
650
Solanum pennellii TA56
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25102)
Chromosome
1
Position
8.64 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10094
Forward primer (5'-3')
TCCGGTTGTTATTGTCACTGGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAAACTTCTTCTGCCTCCTTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 10095
Forward primer (5'-3')
TCCGGTTGTTATTGTCACTGGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAAACTTCTTCTGCCTCCTTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 10096
Forward primer (5'-3')
TCCGGTTGTTATTGTCACTGGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAAACTTCTTCTGCCTCCTTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 32206
Forward primer (5'-3')
TCCGGTTGTTATTGTCACTGGAGC
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 410
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAAACTTCTTCTGCCTCCTTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AflII,DraI,EcoRV,Hpy188I
All possible enzymes for lycopersicum and pimpinellifolium: DraI
  
Accessions and product sizes
Solanum pennellii LA716: 720
Solanum lycopersicum LA925: 720
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g24360F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At1g24360F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g24360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6697 marker 6697
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)