SGN Marker C2_At1g25260

SGN-M6702
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197431---
Lycopersicon CombinedSingleSGN-U213302---
Solanum tuberosumMultipleSGN-U244031---
ArabidopsisSingleAt1g25260 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49205)
Chromosome
1
Position
84.70 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47136)
Chromosome
1
Position
123.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46570)
Chromosome
1
Position
25.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46432)
Chromosome
1
Position
50.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38135)
Chromosome
1
Position
135.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39423
Forward primer (5'-3')
ATCGAACAAAGTCATGCAGGTAGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AACTGATCAAGAGGACCTTCTTGTAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25107)
Chromosome
1
Position
8.85 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g25260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6702 marker 6702
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)