SGN Marker C2_At1g25375

SGN-M6704
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303665 (SGN)
124552 (CGN)
---
Lycopersicon CombinedSingleSGN-U222564---
ArabidopsisSingleAt1g25375 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38136)
Chromosome
5
Position
38.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39424
Forward primer (5'-3')
AACATACAAATTCATTGAGCTCTCTCC
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
ATTCTCTATTGCCATTAAGATGGTTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
150
Solanum pennellii TA56
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25109)
Chromosome
1
Position
8.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 43739
Forward primer (5'-3')
AACATACAAATTCATTGAGCTCTCTCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATTAGATGTGCATCAGTGGATTCTCTC
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g25375  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6704 marker 6704
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)