SGN Marker C2_At1g26640

SGN-M6713
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304340 (SGN)
121500 (CGN)
---
Capsicum annuumSingleSGN-U202895---
Solanum tuberosumSingleSGN-U252260---
ArabidopsisSingleAt1g26640 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25118)
Chromosome
1
Position
9.21 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41064
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
300
Approximate temperature
55°C
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10107
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10108
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10109
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12536
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12537
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12538
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12539
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12540
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12541
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12542
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12543
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12544
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12545
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32737
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32738
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32739
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32740
Forward primer (5'-3')
TCAGAAAGTTTTATTGTTGTTCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAATTCTTGTGGCAACAAAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g26640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6713 marker 6713
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)