SGN Marker C2_At1g26940

SGN-M6717
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200673---
Lycopersicon CombinedSingleSGN-U216875---
ArabidopsisSingleAt1g26940 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49208)
Chromosome
1
Position
5.60 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47139)
Chromosome
1
Position
27.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46574)
Chromosome
11
Position
52.50 cM
Confidence
CF(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46435)
Chromosome
11
Position
42.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38142)
Chromosome
1
Position
27.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41066
Forward primer (5'-3')
AATTTGGTTTCTACCCTAGTGTTGC
Accessions and product sizes
Solanum pennellii TA56
800
Solanum lycopersicum TA209
800
Approximate temperature
55°C
Reverse primer (5'-3')
TACTGCCCTCTGTTCTTCATTCATAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
800
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25122)
Chromosome
1
Position
9.34 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At1g26940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6717 marker 6717
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)