SGN Marker C2_At1g27385

SGN-M6722
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202126---
Lycopersicon CombinedSingleSGN-U228736---
Solanum tuberosumSingleSGN-U250926---
ArabidopsisSingleAt1g27385 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49209)
Chromosome
4
Position
33.22 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47140)
Chromosome
4
Position
35.60 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41317)
Chromosome
5
Position
53.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43293
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38145)
Chromosome
4
Position
55.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39430
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
Accessions and product sizes
Solanum pennellii TA56
1850
Solanum lycopersicum TA209
1850
Approximate temperature
55°C
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
900
Solanum pennellii TA56
750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25127)
Chromosome
1
Position
9.51 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10114
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10115
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10116
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12546
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12547
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12548
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12549
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12550
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12551
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12552
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12553
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12554
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12555
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12556
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12557
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12558
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12559
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32741
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32742
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32743
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32744
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10117
Forward primer (5'-3')
ACCGTGCATGATGATTCAACTAATGAG
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 100+150
Solanum pennellii LA716: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACCAATAGCTGTAAAGCCTCTTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g27385  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6722 marker 6722
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)