SGN Marker C2_At1g27530

SGN-M6724
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299304 (SGN)
121772 (CGN)
---
Capsicum annuumSingleSGN-U202478---
Lycopersicon CombinedSingleSGN-U217285---
ArabidopsisSingleAt1g27530 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41318)
Chromosome
4
Position
115.90 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43294
Forward primer (5'-3')
TTTTGTAGTTTGTTTGGTTTGATGAAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCCATAGCGGCTTGAAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38146)
Chromosome
4
Position
88.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39431
Forward primer (5'-3')
TGTTAACAATCAAAGCTGGTCCACG
Accessions and product sizes
Solanum lycopersicum TA209
1500
Solanum pennellii TA56
1500
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCCATAGCGGCTTGAAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25129)
Chromosome
1
Position
9.56 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10120
Forward primer (5'-3')
TGTTAACAATCAAAGCTGGTCCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCATAGCGGCTTGAAATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 10121
Forward primer (5'-3')
TGTTAACAATCAAAGCTGGTCCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCATAGCGGCTTGAAATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 10122
Forward primer (5'-3')
TGTTAACAATCAAAGCTGGTCCACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCATAGCGGCTTGAAATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 10123
Forward primer (5'-3')
TGTTAACAATCAAAGCTGGTCCACG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCATAGCGGCTTGAAATGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database
BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g27530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D6724 marker 6724
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)